Issue 3

Star anise (Illicium verum Hook. f.) is an important herb in traditional Chinese medicine as well as traditional Asian medicine. The fruit is aromatic and has a strong, pungent and mildly sweet taste. Star anise is one of the many species that contain bioactive compounds as well as a number of phenolic and flavonoid compounds, having antioxidant, preservative and antimicrobial properties. All relevant papers in the English language from researchers of different countries were collected. The keywords of Chinese star anise, anise, traditional Chinese medicine and modern pharmaceutical science were searched in Google Scholar, Scopus, Research Gate and PubMed. Its seeds are good source of minerals like calcium, iron, copper, potassium, manganese, zinc, and magnesium. The essential oil of Chinese star anise contains anethole which has shown several functional properties including antimicrobial, antioxidant, hypoglycemic, hypolipidemic and oestrogenic properties. Due to all positive characteristics, such as antidiabetic, hypolipidemic, antioxidant activities, anticancer and antimicrobial properties, both seeds and essential oils of anise is promising for safe use as super food supplements and raw constituents in the both pharmaceutical and food industries. Anise seed oil contains anethol, estragole, eugenol, pseudisoeugenol, methyl chavicol and anisaldehyde, coumarins, scopoleting, umbelliferon, estrols, terpene hydrocarbons, and polyacetylenes as the major compounds. The plant oil has both pharmacological and clinical effects. The pharmacological effects consist of antimicrobial, hepatopreotective, anticonvulsant, anti-inflammatory, antispasmodic, bronchodilator, estrogenic, expectorant and insecticidal effects, and clinical effects such as nausea, constipation, menopausal period, virus, diabetes, obesity and sedative action. Combined with a nutritious diet, other traditional Chinese and Asian medicine, Chinese star anise and ansie seed may improve various aspects of health. More clinical studies are necessary to uncover the numerous substances and their effects in ginseng that contribute to public health.

The objectives of this study was to assess the prevalence of overweight and obesity in a sample of students from the Patuakhali Science and Technology University, Bangladesh and examine their usual eating habits. A cross-sectional survey of 260 students (65.38% male and 34.62% female) aged 20.81 ± 1.63 were chosen randomly from the Patuakhali Science and Technology University campus during May to July 2019. Students were asked to fill out a self-reported questionnaire that included questions on their eating, drinking and smoking habits. Also, their weight, height and body mass index were measured. Body mass index (BMI) was used to assess students' weight status. Statistical analyses were performed using the SPSS software (version 23.0). Results shows that, majority of the students (67.3%) were of normal weight. Based on BMI classification, the prevalence of overweight was more common among the male students compared to females (23.5% vs. 10%). In contrast, prevalence of obesity was more common among female students (3.3% vs. 2.9%). A significant difference in BMI was observed between male and female students (p <0.01). The majority of the students (70.4%) reported that they took meals regularly. In terms of breakfast intake, less than half of the students (44.6%) reported that they took their breakfast daily. There was a significant gender difference in the frequency of snacks intake apart from regular meal (p <0.05). Female students were more prone to snacks consumption compared with male students. The unhealthy eating habits of the students was indicated by the fact that near about half of the students (46%) reported eating fried food daily or three to four times per week. Soft drinks consumption among the students were significantly associated with gender (p <0.05). The present results suggest the necessity of nutrition and health promotion programs for university students, especially programs emphasizing weight management.

Rheumatic heart disease (RHD) is a significant public health problem and Non-adherence to treatment is an important and often unrecognized risk factor for cardiovascular mortality. The study aimed to assess self-reported medication adherence by 8-item Morisky Medication Adherence Scale (MMAS-8) among rheumatic heart disease patients and determine the associated factors. A cross-sectional study was carried out by applying a structured interview to Rheumatic heart disease patients aged 18 or higher in a tertiary hospital in Bangladesh. Among Rheumatic heart disease patients, 63.5% showed medium adherence, 36.5% showed low adherence to medication. Walking habit (P= 0.000), exercise habit (P=0.000), smoking habit (P=0.000), and duration of RHD (P=0.005) found significantly associated with medication adherence. Multiple logistic regression analysis also revealed, don't have walking habit more than 10 minutes at a time (AOR=2.416, 95% CI: 1.212-4.816), don't having exercise habit (AOR=2.420, 95% CI: 1.206 – 4.859), don't having habit of smoking (AOR=0.392, 95% CI: 0.183 – 0.841), duration of RHD for less than 15 (AOR=4.190, 95% CI: 0.851 – 20.631) are independent predictors of adherence. Our study demonstrated medium to low medication adherence in the Morisky Medication Adherence Scale among rheumatic heart disease patients.

The objective of this study was to prepare the skeletons of duck to enhance veterinary anatomy teaching. Five aged ducks were used in this experiment, which was collected from the Bangladesh Agricultural University poultry farm. The ducks were skinned and different segments of the body were dissected with the help of a scalpel. Then the bones were wrapped using merkin clothes, heated in 5% solution of soda water for 1 hour, and kept in that solution for 7 days for decomposing the muscles, tendon and ligaments. For proper cleaning, the bones were dipped into 10% bleaching water for 2 hours. After complete sundry, the bones were articulated using super glue for rising into a skeleton. The vertebral column was aligned with 25-gauge steel wire was inserted into the vertebral foramen. Finally, the skeletons were fixed on a wooden stand. Therefore, the skeletons were preserved and used for demonstration of osteology, and avian anatomy. This duck skeleton will be used to study avian morphology and make a comparative analysis with other mammals.

Aging is one of the embryonic problems in Bangladesh and this has been gradually increasing with its far-reaching consequences. Elderly can develop new and complicating health problems. In most cases the diseases are chronic and complex. The structures were designed to investigate the health status, depression, and function of the daily living of the older men and women in the Sylhet region of Bangladesh. The data were collected using stratified sampling. We have used cross-sectional methods to analyze the data and performed a chi-square test to test the association and a then bivariate and multivariable logistic regression model was used to evaluate the major risk factors of CVD. In this study, 229 elderly people were considered aged from 60 to 60+ years-old face to face personal interviews. Among them 16.6% elderly are suffering in depression. According to residence, the condition of health is good in the ethnic group (21.9%) and this situation is worse in the rural group (97.5%). In addition, people who have depression were 0.087 times or 91.3% (OR = 1.115, 95% CI 0.273-4.552) less likely to have healthy compared to the people who did not have depression. In this study, we have seen that there were many factors that were associated with health status among different communities’ elderly people in Sylhet. This research will help clinicians and policymakers to develop appropriate strategies of CVD patients and organize health education programs for changing lifestyles among elderly in Sylhet.

Thrombocytopenia is a relatively uncommon extra-hepatic manifestation of uncomplicated chronic hepatitis B virus (HBV) infection. This study has two aims: to assess the prevalence of thrombocytopenia in non-cirrhotic patients with chronic hepatitis B (CHB); and to determine the association of certain variables with thrombocytopenia in Duhok province.  It is a case control study conducted in Azadi Teaching Hospital during June 2016 - May 2019. Chronic active hepatitis B was defined according to the following parameters: the presence of detectable hepatitis B surface antigen (HBsAg) in the blood longer than six months, positive or negative HBeAg, HBV-DNA level >2000 IU/ml, elevated ALT, and/or at least moderate histopathological fibrosis. Thrombocytopenia was defined as platelet counts below 150,000/μl. The obtained results were analyzed by entering data into Microsoft Excel 2010. A total of 379 CHB patients and 200 cases as control were enrolled in this study. Their mean ages were 33.62 ± 14.48 and 40.72 ± 18.56 for HBV and control cases, respectively. There were 236 (62.27%) males in the HBV patients and 109 (54.50%) males in the control group. Comparing both groups, significant association was found between HBV and younger age, cigarette smoking, and alcohol consumption. Chronic active hepatitis B without liver cirrhosis was strongly associated with an increased rate of thrombocytopenia. This finding is paramount as it is statistically significant (P = 0.042). Significant association with younger age and Syrian nationality was found more in CHB patients with thrombocytopenia compared to non-thrombocytopenic. In conclusion, chronic active hepatitis B is strongly associated with thrombocytopenia. As hypersplenism resulting from liver cirrhosis was excluded in our patients, the cause of thrombocytopenia is due to other mechanisms. Therefore, it is important to consider CHB in the differential diagnosis of patients presenting with isolated thrombocytopenia. Older age and Syrian nationality were predictors for developing thrombocytopenia in chronic active HBV infection.

To evaluate the visual outcome in patients who have had their cataract surgery in a tertiary hospital of Chittagong district in Bangladesh. This is a clinic-based study of consecutive cataract-operated patients who had age-related cataract with vision less than <6/60 before surgery. A total of 228 patients who visited the hospital and met the eligibility criteria were included in the study. The mean age of the patients was 62.46± 10.14 years and 134 (58.8%) were female. A total of 456 surgeries were performed on 228 patients. The most common procedure was small incision cataract surgery (SICS) with intraocular lens (IOL) implantation, operated in 422(92.5%) eyes. Among cataract-operated eyes, 290 (64%) had presenting vision >6/18 and <6/60 were found in 11 (2.4%) eyes. In most of the cases, visual acuity has improved after best correction as the percentages with the best correction were 402(88%) and 7(1.55%) respectively. Analysis of multiple logistic regression shows that patient’s older age (OR 9.101; 95% CI 3.331, 24.869), gender female (OR 2.374 CI 1.403, 4.017), literacy (OR 1.660; CI 1.009, 2.733) and SICS surgery technique (OR 3.540; CI1.298, 9.659) were significantly associated with poor visual outcome. Overall, this study demonstrates that cataract surgery can restore good visual acuity. However, the visual outcome needs to be improved to meet the WHO standard, and more attention should be directed towards monitoring of outcomes and correction of refractive error after cataract surgery.

Salmonella enterica is a zoonotic pathogen which can readily pass from animal to man through the consumption of contaminated food. This study was designed to determine molecular characterization of Salmonella and antibiotic resistance profiles of Salmonella recovered from internal organs of dead turkey. A total of 40 internal organ samples from dead turkey were collected from different turkey farms in Dinajpur district. Among the samples 12 (30%) were positive for Salmonella. Salmonella virulence factors were determined using the polymerase chain reaction assays targeting the virulence gene &16S rRNA gene region was amplified with the universal primers, forward primer- 27F (5'AGAGTTTGATCCTGGCTCAG 3') and reverse primer- 1492R (5' TACCTTGTTACGACTT 3'). PCR amplification band was found at 1470 bp. Among the different serotypes, Salmonella enterica was identified by using phylogenetic tree analysis. Antibiotic resistance analysis indicates that Salmonella spp. were 100% sensitive to Azithromycin, Kanamycin, Norfloxacin and Chloramphenicol. The isolates were 100% resistant to Cefradine, Cloxacillin, Bacitracin, Levofloxacin, Amoxicillin, Nalidixic acid and Tetracycline. In conclusion, this study provides that the isolated Salmonella spp. were found to AMR in response to variety of multi drugs. Salmonella enterica can cause a wide range of illnesses, ranging from gastroenteritis to acute, life-threatening enteric fever for turkey. This study suggests that turkeys may act as a reservoir for these strains which can be transferred to humans.

Gladiolus is high demandable and popular flower all over the world. The present study was conducted to investigate the effect of plant spacing and corm size on growth and spike production of gladiolus. The two factor experiment was laid out in Randomized Complete Block Design (RCBD). Three plant spacing like S₁= 25×20 cm, S₂= 20×30 cm and S₃= 25×30 cm and corm size like L₁=Small corm, (30±2 g), L₂=Medium corm (35±2 g), L₃=Large corm (>40g) were maintained to investigate the study. Plant spacing and corm size had significant effect on days to 80% emergence, plant height, number of leaves, days required for first spike initiation, spike length, rachis length, number of florets per spike and weight of spike. The highest number of plant height (74.61 cm), maximum number of leaves (7.98), top most length of spike (70.00), utmost rachis length (48.77 cm), largest number of florets per spike (14.33) and maximum weight of spike (35.60) were obtained from the plant spacing 25x30cm and largest corm size > 40g. Therefore, the results of the present study revealed that widest plant spacing 25×30 cm and large corm (>40g) were found to be the best for growth of spike production of gladiolus.

Camel milk is an important nutritional source that historically been used in the treatment of cancer. Therefore, the main aim of the present study is to determine the in vitro anticancer effect of both camel milk and whey against cervix cancer (HeLa) cells. To perform that, skimmed milk as well as whey immunoglobulins concentrate samples were prepared at different concentrations (0, 1, 2.5, 5, 7.5 and 10 mg/ml). Then, the in vitro effect of the prepared concentrations on HeLa cells morphology and growth was investigated by tissue culture technique. Moreover, the anticancer activity of camel milk and whey against HeLa cells was estimated by the 3-[4, 5-dimethylthiazole-2-yl]-2, 5-diphenyltetrazolium bromide (MTT) assay. The obtained results displayed that both camel milk and whey reduced the viability of HeLa cells specially at 7.5 and 10 mg/ml. In addition, the viability of treated HeLa cells reduced after addition of both camel milk and whey to approximately 15% in a concentration dependent manner. In conclusion, this study showed the in vitro cytotoxic effect of camel milk and whey as they inhibited the growth of HeLa cells.